Journal: The Journal of antibiotics

Article Title: Vibrio inhibens sp. nov., a novel bacterium with inhibitory activity against Vibrio species.

doi: 10.1038/ja.2012.22

Figure Lengend Snippet: Figure 1 Phylogenetic dendrogram of strain BFLP-10T with the most closely related Vibrio species, based on 16S rRNA gene sequences and constructed by the neighbour-joining method. Bootstrap percentages (450%) based on 1000 replications are shown at branch nodes. Vibrio cholerae ATCC 14035T was used as an outgroup. Bar, 0.01 substitutions per nucleotide position.

Article Snippet: Positive for catalase, oxidase, lysine-and ornithine-decarboxylase, V. campbellii ATCC 25920T (X74692) V. rotiferianus LMG 21460T(AJ316187) V. harveyi ATCC 14126T (X74706) V. alginolyticus ATCC 17749T (X74690) V. parahaemolyticus ATCC 17802T (X74720) V. azureus LC2-005T (AB428897) V. owensii DY05T (GU018180) V. communis R-40496T (GU078672) V. inhibens BFLP-10T (FN687911) V. proteolyticus ATCC 15338T (X74723) V. tubiashii ATCC 19109T (X74725) V. atypicus HHS02T (FJ009624) V. diabolicus HE800T (X99762) V. mytili CECT 632T (X99761) V. brasiliensis LMG 20546T (AJ316172) V. nereis ATCC 25917T (X74716) V. hepatarius LMG 20362T (AJ345063) V. xuii LMG 21346T(AJ316181) V. cholerae ATCC 14035T (EF032498) V. fortis LMG 21557T(AJ514916) V. agarivorans CECT 5085T (AJ310647) V. hangzhouensis CN83T (EU082035) V. ezurae HDS1-1T (AY426980) V. halioticoli IAM 14596T (AB000390) 0.01 86 60 87 52 54 98 64 75 70 71 55 79 80 92 Figure 1 Phylogenetic dendrogram of strain BFLP-10T with the most closely related Vibrio species, based on 16S rRNA gene sequences and constructed by the neighbour-joining method.

Techniques: Construct

Journal: The Journal of antibiotics

Article Title: Vibrio inhibens sp. nov., a novel bacterium with inhibitory activity against Vibrio species.

doi: 10.1038/ja.2012.22

Figure Lengend Snippet: Figure 2 Phylogenetic tree based on the concatenated sequences of the four housekeeping genes (2237 bp). This tree combines the results of both the neighbour-joining (NJ) and maximum-parsimony (MP) methods. The topology shown was obtained by using the NJ method. Bootstrap percentages based on 1000 replications are shown at branch nodes (NJ/MP). V. cholerae ATCC 14035T was used as an outgroup. Bar, 0.02 substitutions per nucleotide position.

Article Snippet: Positive for catalase, oxidase, lysine-and ornithine-decarboxylase, V. campbellii ATCC 25920T (X74692) V. rotiferianus LMG 21460T(AJ316187) V. harveyi ATCC 14126T (X74706) V. alginolyticus ATCC 17749T (X74690) V. parahaemolyticus ATCC 17802T (X74720) V. azureus LC2-005T (AB428897) V. owensii DY05T (GU018180) V. communis R-40496T (GU078672) V. inhibens BFLP-10T (FN687911) V. proteolyticus ATCC 15338T (X74723) V. tubiashii ATCC 19109T (X74725) V. atypicus HHS02T (FJ009624) V. diabolicus HE800T (X99762) V. mytili CECT 632T (X99761) V. brasiliensis LMG 20546T (AJ316172) V. nereis ATCC 25917T (X74716) V. hepatarius LMG 20362T (AJ345063) V. xuii LMG 21346T(AJ316181) V. cholerae ATCC 14035T (EF032498) V. fortis LMG 21557T(AJ514916) V. agarivorans CECT 5085T (AJ310647) V. hangzhouensis CN83T (EU082035) V. ezurae HDS1-1T (AY426980) V. halioticoli IAM 14596T (AB000390) 0.01 86 60 87 52 54 98 64 75 70 71 55 79 80 92 Figure 1 Phylogenetic dendrogram of strain BFLP-10T with the most closely related Vibrio species, based on 16S rRNA gene sequences and constructed by the neighbour-joining method.

Techniques:

Journal: Journal of Pathogens

Article Title: Emergence of Tetracycline Resistant Vibrio cholerae O1 Biotype El Tor Serotype Ogawa with Classical ctxB Gene from a Cholera Outbreak in Odisha, Eastern India

doi: 10.1155/2016/1695410

Figure Lengend Snippet: Comparison of V. cholerae strains isolated during two cholera outbreaks in 2007 and 2010 from Rayagada, Odisha.

Article Snippet: Other bacterial reference strains used in the study were V. cholerae O1 El Tor (ATCC 14033), V. cholerae O1 classical (ATCC 11623), and V. cholerae O139 (ATCC 51394).

Techniques: Comparison, Isolation

Journal: Journal of Pathogens

Article Title: Emergence of Tetracycline Resistant Vibrio cholerae O1 Biotype El Tor Serotype Ogawa with Classical ctxB Gene from a Cholera Outbreak in Odisha, Eastern India

doi: 10.1155/2016/1695410

Figure Lengend Snippet: Effect of CCCP on minimum inhibitory concentration (MIC) of various antibiotics on V. cholerae isolates.

Article Snippet: Other bacterial reference strains used in the study were V. cholerae O1 El Tor (ATCC 14033), V. cholerae O1 classical (ATCC 11623), and V. cholerae O139 (ATCC 51394).

Techniques: Concentration Assay

Journal: Journal of Pathogens

Article Title: Emergence of Tetracycline Resistant Vibrio cholerae O1 Biotype El Tor Serotype Ogawa with Classical ctxB Gene from a Cholera Outbreak in Odisha, Eastern India

doi: 10.1155/2016/1695410

Figure Lengend Snippet: Amino acid sequence alignment of CTB subunit of V. cholerae O1 El Tor isolates from Odisha outbreak with preexisting reference El Tor and classical strains. Identical amino acid residues are indicated by dots. Amino acid sequences of V. cholerae CTB used in alignment were taken from GenBank.

Article Snippet: Other bacterial reference strains used in the study were V. cholerae O1 El Tor (ATCC 14033), V. cholerae O1 classical (ATCC 11623), and V. cholerae O139 (ATCC 51394).

Techniques: Sequencing

Journal: Journal of Pathogens

Article Title: Emergence of Tetracycline Resistant Vibrio cholerae O1 Biotype El Tor Serotype Ogawa with Classical ctxB Gene from a Cholera Outbreak in Odisha, Eastern India

doi: 10.1155/2016/1695410

Figure Lengend Snippet: Genetic structures and CTX prophage array of V. cholerae strains. Block arrows indicate the transcription direction of each gene. Black triangles on the genome indicate the repeat sequence flanking the integrated phage DNA. V. cholerae isolates in this study contain a single RS1 element and a single classical CTX prophage after the TLC element on chromosome I.

Article Snippet: Other bacterial reference strains used in the study were V. cholerae O1 El Tor (ATCC 14033), V. cholerae O1 classical (ATCC 11623), and V. cholerae O139 (ATCC 51394).

Techniques: Blocking Assay, Sequencing

Journal: The ISME Journal

Article Title: High-throughput isotopic analysis of RNA microarrays to quantify microbial resource use

doi: 10.1038/ismej.2011.175

Figure Lengend Snippet: Chip-SIP analysis of mixtures of two bacterial strains labeled with differential isotopic enrichment; HCE, hybridization-corrected enrichment (slope of per mil enrichment and fluorescence). Each point represents an individual probe spot's fluorescence intensity value plotted against its isotopic enrichment. Comparisons included dual labeled V. cholera and B. cereus (a, b), 15N labeled P. stutzeri and unlabeled B. cereus (c), and differentially 13C labeled V. cholerae and P. stutzeri (d).

Article Snippet: Strains of Pseudomonas stutzeri ATTC 11607, Vibrio cholerae ATCC 14104 and Bacillus cereus D17 were grown from −80 °C frozen stocks in Luria-Bertani broth at 37 °C, transferred to the M9 minimal medium and then inoculated into M9 enriched in 13 C glucose (99% 13 C, uniformly labeled, Omicron Biochemicals, Inc., South Bend, IN, USA) and/or 15 N ammonium (98% 15 N, Sigma-Aldrich, St Louis, MO, USA) at isotope concentrations ranging from 0.1% to 100%.

Techniques: Labeling, Hybridization, Fluorescence

Journal:

Article Title: TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater †

doi: 10.1128/AEM.67.10.4685-4693.2001

Figure Lengend Snippet: Sensitivity of the fluorogenic TaqMan PCR assay for detection of pathogenic 10-fold dilutions of V. cholerae serotype O1 (□; ATCC 14035) and O139 (○; ATCC 51394) in SSW. Experiments were done in triplicate. DNA was amplified with the hlyA TaqMan primers in the presence of the hlyA fluorogenic probe. The average ΔRQ values determined from DNA recovered from both serotypes were plotted against the CFU per milliliter. The average ΔRQ threshold values at four times the average of no-template controls were calculated to be 2.80 and 2.83 for V. cholerae O1 and O139, respectively (line across the graph). Error bars indicate the standard deviations of the means.

Article Snippet: A complete list of bacterial strains that were evaluated is given in Tables and . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Bacteria evaluated No. of isolates tested Collection or isolation source a ΔRQ value b Interpretation c Vibrio alginolyticus 5 WL104, L, O 1.0 Negative 85-2-4, L, CF 1.2 Negative WL118, CF, L 0.0 Negative WL121 0.8 Negative WL210, L, O 0.9 Negative Vibrio anguillarum 5 WL83, L, S 0.1 Negative WL87, O 0.2 Negative WL85, L, O 0.0 Negative WL89, L, CF 0.4 Negative 99-053B 0.0 Negative Vibrio cholerae serotype O1 13 ATCC 14035, I 30.1 Positive ATCC 14735, C, I 33.2 Positive 0395N1 34.0 Positive WL11, C, P 35.4 Positive WL13, C 34.0 Positive WL26, S, P 35.2 Positive WL31, C, I 32.2 Positive WL34 33.0 Positive WL36, C, M 35.8 Positive WL41 32.4 Positive WL65 34.4 Positive WL69 33.8 Positive WL99 31.4 Positive Vibrio cholerae serotype O139 13 ATCC 51394 32.1 Positive ATCC 25874, C 30.1 Positive WL29, C, I 33.1 Positive WL32 33.2 Positive WL33 32.0 Positive WL34 35.4 Positive WL42, L, O 34.4 Positive WL50 35.2 Positive WL37 32.2 Positive WL38 33.0 Positive WL39 35.5 Positive WL40 36.8 Positive NCTC 8457, I, C 35.8 Positive Vibrio cholerae serotype non-O1 9 ATCC 25872, C 35.0 Positive ATCC 25873, C 34.0 Positive N2030 35.4 Positive WL102, L, EN 36.0 Positive WL105, L, O 35.2 Positive WL111 32.2 Positive WL115 35.0 Positive WL116 34.4 Positive WL119 35.2 Positive Vibrio cholerae serotype non-O139 3 WL42, L, O 32.2 Positive NCTC 8457, C, I 33.0 Positive WL29, C, I 34.0 Positive Vibrio damsela 3 ATCC 33539, CF, CA 0.0 Negative CDC 23–81, S, F 0.0 Negative CDC 183-79, C, H 0.0 Negative Vibrio fluvialis 2 ATCC 33809, C, I 0.0 Negative CDC 1280-78, C, I 0.0 Negative Vibrio mimicus 2 ATCC 33653,C, NC 2.0 Negative CDC 269–80, S, LA 1.8 Negative Vibrio parahaemolyticus 6 ATCC 17802, C, J 0.0 Negative ATCC 27519, S, LA 0.0 Negative WL78, L, C 0.1 Negative 90-299 0.2 Negative WL90, L, S 0.0 Negative ATCC 49398, C, M 0.3 Negative Vibrio vulnificus 6 ATCC 27562, C 0.0 Negative CDC A1402, C 0.1 Negative 89–142 0.1 Negative WL43, L, O 0.0 Negative CDC A8694, C, F 0.0 Negative WL76, L, S 0.2 Negative Open in a separate window a ATCC, American Type Culture Collection; CDC, Centers for Disease Control and Prevention, Atlanta, Ga.; NCTC, National Collection of Type Cultures, London, England.

Techniques: Amplification

Journal:

Article Title: TaqMan PCR for Detection of Vibrio cholerae O1, O139, Non-O1, and Non-O139 in Pure Cultures, Raw Oysters, and Synthetic Seawater †

doi: 10.1128/AEM.67.10.4685-4693.2001

Figure Lengend Snippet: Sensitivity of the fluorogenic TaqMan PCR assay for detection of pathogenic V. cholerae O1 and O139 in spiked oyster samples (A) and spiked SSW (B). Tenfold dilutions of V. cholerae serotype O1 (□; ATCC 14035) and O139 (○; ATCC 51394) in SSW were done in triplicate. DNA was amplified with the hlyA TaqMan primers in the presence of the hlyA fluorogenic probe. The average ΔRQ values determined from DNA recovered from both serotypes were plotted against either the CFU per gram or CFU per milliliter. Delta RQ average threshold values are defined as four times the average of no-template controls and are shown for spiked oyster samples (A) and SSW samples (B) as 3.3 and 2.5 (line across the graphs), respectively. Error bars indicate the standard deviations of the means.

Article Snippet: A complete list of bacterial strains that were evaluated is given in Tables and . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Bacteria evaluated No. of isolates tested Collection or isolation source a ΔRQ value b Interpretation c Vibrio alginolyticus 5 WL104, L, O 1.0 Negative 85-2-4, L, CF 1.2 Negative WL118, CF, L 0.0 Negative WL121 0.8 Negative WL210, L, O 0.9 Negative Vibrio anguillarum 5 WL83, L, S 0.1 Negative WL87, O 0.2 Negative WL85, L, O 0.0 Negative WL89, L, CF 0.4 Negative 99-053B 0.0 Negative Vibrio cholerae serotype O1 13 ATCC 14035, I 30.1 Positive ATCC 14735, C, I 33.2 Positive 0395N1 34.0 Positive WL11, C, P 35.4 Positive WL13, C 34.0 Positive WL26, S, P 35.2 Positive WL31, C, I 32.2 Positive WL34 33.0 Positive WL36, C, M 35.8 Positive WL41 32.4 Positive WL65 34.4 Positive WL69 33.8 Positive WL99 31.4 Positive Vibrio cholerae serotype O139 13 ATCC 51394 32.1 Positive ATCC 25874, C 30.1 Positive WL29, C, I 33.1 Positive WL32 33.2 Positive WL33 32.0 Positive WL34 35.4 Positive WL42, L, O 34.4 Positive WL50 35.2 Positive WL37 32.2 Positive WL38 33.0 Positive WL39 35.5 Positive WL40 36.8 Positive NCTC 8457, I, C 35.8 Positive Vibrio cholerae serotype non-O1 9 ATCC 25872, C 35.0 Positive ATCC 25873, C 34.0 Positive N2030 35.4 Positive WL102, L, EN 36.0 Positive WL105, L, O 35.2 Positive WL111 32.2 Positive WL115 35.0 Positive WL116 34.4 Positive WL119 35.2 Positive Vibrio cholerae serotype non-O139 3 WL42, L, O 32.2 Positive NCTC 8457, C, I 33.0 Positive WL29, C, I 34.0 Positive Vibrio damsela 3 ATCC 33539, CF, CA 0.0 Negative CDC 23–81, S, F 0.0 Negative CDC 183-79, C, H 0.0 Negative Vibrio fluvialis 2 ATCC 33809, C, I 0.0 Negative CDC 1280-78, C, I 0.0 Negative Vibrio mimicus 2 ATCC 33653,C, NC 2.0 Negative CDC 269–80, S, LA 1.8 Negative Vibrio parahaemolyticus 6 ATCC 17802, C, J 0.0 Negative ATCC 27519, S, LA 0.0 Negative WL78, L, C 0.1 Negative 90-299 0.2 Negative WL90, L, S 0.0 Negative ATCC 49398, C, M 0.3 Negative Vibrio vulnificus 6 ATCC 27562, C 0.0 Negative CDC A1402, C 0.1 Negative 89–142 0.1 Negative WL43, L, O 0.0 Negative CDC A8694, C, F 0.0 Negative WL76, L, S 0.2 Negative Open in a separate window a ATCC, American Type Culture Collection; CDC, Centers for Disease Control and Prevention, Atlanta, Ga.; NCTC, National Collection of Type Cultures, London, England.

Techniques: Amplification

Journal: Journal of Clinical Microbiology

Article Title: Identification of Clinically Relevant Viridans Streptococci by an Oligonucleotide Array

doi: 10.1128/jcm.43.4.1515-1521.2005

Figure Lengend Snippet: FIG. 1. Hybridization of 11 species of VS and other microorganisms to the oligonucleotide arrays. The positions of oligonucleotide probes are indicated in the upper left-hand array, and their sequences are indicated in Table 2. The strain tested is indicated at the bottom of each array. Probes 2 and 3 are positive control probes designed from the ITS region of X. flavus BCRC 12271. Probes 4 to 8 are negative controls (tracking dye only).

Article Snippet: Oligonucleotide probes used in this study Microorganism Probe codea Sequenceb (5 to 3 ) Probe locationc Length(mer) Tm d (°C) GenBankaccession no. S. parasanguinis ATCC 15912 1 ACACTATAGTAGTGTTAAGC 130–149 20 43.6 AY351320 X. flavus BCRC 12271 2e GCTGTATGACATCGTGAATAGGGCATT 577–603 27 60 AY684797 X. flavus BCRC 12271 3e TTCTGACTTAAGATGTCGGAAGCGTTT 490–516 27 60 AY684797 Negative control 4–8f S. sanguinis ATCC 10556 9 GACACACGGAATGCACTTGA 17–36 20 53.1 AY347565 S. sanguinis ATCC 10556 10 TCTAGTTTGACTAGATAAAGAACTT 141–163 25 48.2 AY347565 S. anginosus ATCC 33397 11 AGAATCCTACTGAACTTAATAAAGAAGTGAT 137–166 31 52.7 AY347541 S. uberis ATCC 13386 12 AAGGATAAGGAACACGTTGGTTAAGTCTT 1–27 29 49 AY347566 S. uberis ATCC 13386 13 GGATACAGTTCAACTGAACTTAATA 149–173 25 47.3 AY347566 S. uberis ATCC 13386 14 CATTGTATCTTAGTATAGTCCATTG 184–280 25 52.1 AY347566 S. mutans ATCC 31377 15 ATCTAGGATACAAAGAGATGTTCGG 258–282 25 52.1 AY351324 S. gordonii ATCC 10558 16 GAAGTTCCAAACTAGTCCATTG 136–158 22 49.3 AY353081 S. mitis BCRC 14732 17 AATAAAACCGAAAACGCTGTAGT 190–211 23 44.8 AY347550 S. oralis BCRC 14749 18 AATAAAACCGAAACGCTGTAGT 190–210 22 44.1 AY347551 S. constellatus ATCC 27513 19 ATCTAGGATGCAAAGAAATGAGATT 129–151 25 50.6 AY347545 S. intermedius ATCC 27335 20 AGGATATGGAATTCACCTTTAGTTG 132–156 25 50.9 AY347549 S. intermedius ATCC 27335 21 ATGATATCCTAAAGTAGCACATTGA 157–181 25 49.9 AY347549 S. intermedius ATCC 27335 22 TTTAGTTGATGATATCCTAAAGTAG 149–173 25 46.3 AY347549 S. salivarius ATCC 13419 23 CATATGTAATTACTTACATATAGATAGTAA 184–213 30 46.1 AY347562 S. salivarius ATCC 13419 24 CTAAGGAAAACGGAATGTACTTGAG 1–26 25 52.1 AY347562 a Oligonucleotide probes are arranged on the array as indicated in Fig. 1. b Ten thymine bases were added to the 3 end of each probe. c The locations of the probes are shown by the nucleotide number of the ITS sequence of the respective strain. d Tm was calculated with the melttemp command in the Wisconsin Genetics Computer Group Package (Accelrys Inc.), based on a 50 mM Na concentration. e Probes 2 and 3 were used as positive controls. f Spots 4 to 8 in Fig. 1 contained dye only and were used as negative controls. on M ay 29, 2015 by U N IV O F G E O R G IA http://jcm .asm .org/ D ow nloaded from product of the test organism and 10 l of the denatured PCR product amplified from X. flavus (the positive control) were diluted with 0.5 ml of hybridization solution and added to each well.

Techniques: Hybridization, Positive Control